circad | circRNAs associated with diseases

circ-KIAA1244
Gene	KIAA1244	Organism	Human
Genome Locus		Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink		PMID	30236115
Experimental Method
Sample Type	Tissue and cell lines	Comparison	0 GC patients with different TNM stages and 5 healthy individuals as controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CAGTTACGACAGAGGCAGGA Reverse CAGCAGGCATTTCTCCTTTATG	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Tang, W, Fu, K, Sun, H, Rong, D, Wang, H, Cao, H (2018). CircRNA microarray profiling identifies a novel circulating biomarker for detection of gastric cancer. Mol. Cancer, 17, 1:137.